fam102ab

Ensembl ID:
ENSDARG00000016866
ZFIN ID:
ZDB-GENE-060929-412
Description:
early estrogen-induced gene 1 protein [Source:RefSeq peptide;Acc:NP_001070081]
Human Orthologue:
FAM102A
Human Description:
family with sequence similarity 102, member A [Source:HGNC Symbol;Acc:31419]
Mouse Orthologue:
Fam102a
Mouse Description:
family with sequence similarity 102, member A Gene [Source:MGI Symbol;Acc:MGI:2138935]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11177 Essential Splice Site Available for shipment Available now
sa9710 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11177
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098188 Essential Splice Site None 387 2 14
ENSDART00000122066 Essential Splice Site None 387 2 13
ENSDART00000137556 Essential Splice Site None 398 2 13
Genomic Location:
Chromosome 5 (position 33410381)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGAGACTGTAGCTTTCTCACAGTGCTGCCCARTAAAGTGCTTTTAAGG[T/C]GAGTTGTTATATCGTTTCTAATGCTAAATTAATTTAGKCTCAGTCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098188 Essential Splice Site 138 387 6 14
ENSDART00000122066 Essential Splice Site 138 387 6 13
ENSDART00000137556 Essential Splice Site 138 398 6 13
Genomic Location:
Chromosome 5 (position 33368106)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGGCTACGACACMAAGAACACTCGRCAAGACAACTCCATACTCAAG[G/A]TGAGCACGYCTTTTGTYTGTGGAAAAAGACTTGTGCGTGTGTAGGTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/erp1fp6d