farsb

Ensembl ID:
ENSDARG00000016864
ZFIN ID:
ZDB-GENE-021206-2
Description:
phenylalanyl-tRNA synthetase beta chain [Source:RefSeq peptide;Acc:NP_001007769]
Human Orthologue:
FARSB
Human Description:
phenylalanyl-tRNA synthetase, beta subunit [Source:HGNC Symbol;Acc:17800]
Mouse Orthologue:
Farsb
Mouse Description:
phenylalanyl-tRNA synthetase, beta subunit Gene [Source:MGI Symbol;Acc:MGI:1346035]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3909 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015979 Essential Splice Site 90 590 4 17

The following transcripts of ENSDARG00000016864 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 40808230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATAAAAACAAGTGRTGTTATATGCATTAAATATATGGCTGKTTTGCA[G/A]GATGGAAGCTCCTCGGTACAAGCGTGTGAGTCCTGCGGATGGAGGAGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5bq0e5tf