glipr2l

Ensembl ID:
ENSDARG00000016837
ZFIN ID:
ZDB-GENE-041010-53
Description:
Golgi-associated plant pathogenesis-related protein 1 [Source:RefSeq peptide;Acc:NP_001005978]
Human Orthologue:
GLIPR2
Human Description:
GLI pathogenesis-related 2 [Source:HGNC Symbol;Acc:18007]
Mouse Orthologue:
Glipr2
Mouse Description:
GLI pathogenesis-related 2 Gene [Source:MGI Symbol;Acc:MGI:1917770]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22860 Nonsense Available for shipment Available now
sa42735 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005625 Nonsense 133 154 5 5
Genomic Location (Zv9):
Chromosome 16 (position 29849769)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27686907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGCAAAGCTGTGGCCTCAGATGGTTCCACCTTCGTGGTGGCACGTTA[T/A]TTCCCAGCTGGCAACATTACCAATCAGGGCCACTTCCAGGCTAACGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005625 Nonsense 142 154 5 5
Genomic Location (Zv9):
Chromosome 16 (position 29849794)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27686932
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCACCTTCGTGGTGGCACGTTATTTCCCAGCTGGCAACATTACCAAT[C/T]AGGGCCACTTCCAGGCTAACGTCCTGCCCCCTAAAAGCTGATCCAAATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link