tcirg1

Ensembl ID:: ENSDARG00000016835
ZFIN ID:: ZDB-GENE-090311-31
Description:: Novel protein similar to H.sapiens ATPase, H+ transporting, lysosomal V0 subunit [Source:UniProtKB/T
Human Orthologue:: TCIRG1
Human Description:: T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3 [Source:HGNC Symbol;Acc
Mouse Orthologue:: Tcirg1
Mouse Description:: T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3 Gene [Source:MGI Symbol

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa1773	Nonsense	Confirmed mutation in F2 line	During 2015

Mutation Details

Allele Name:: sa1773
Current Status:: Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000033405	Nonsense	581	823	15	20
ENSDART00000136419		None	117	None	3
ENSDART00000145354	Nonsense	581	666	15	16

Genomic Location:: Chromosome 1 (position 45340428)
KASP Assay ID:: 554-1766.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: GTGAGCAGTGTGTTCCTGGTGTTGATTCCTGAGTTAGTGTTCATGTTGTG[T/A]CTTTTCGGGTACCTGGTCTTCATGGTGGTGTTTAAATGGATTGCGTTTGG
Associated Phenotype:: Not determined

OMIM

Osteopetrosis, autosomal recessive 1

More OMIM information for TCIRG1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: