tcirg1

Ensembl ID:
ENSDARG00000016835
ZFIN ID:
ZDB-GENE-090311-31
Description:
Novel protein similar to H.sapiens ATPase, H+ transporting, lysosomal V0 subunit [Source:UniProtKB/T
Human Orthologue:
TCIRG1
Human Description:
T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3 [Source:HGNC Symbol;Acc
Mouse Orthologue:
Tcirg1
Mouse Description:
T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3 Gene [Source:MGI Symbol

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1773 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa1773
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033405 Nonsense 581 823 15 20
ENSDART00000136419 None None 117 None 3
ENSDART00000145354 Nonsense 581 666 15 16
Genomic Location:
Chromosome 1 (position 45340428)
KASP Assay ID:
554-1766.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGCAGTGTGTTCCTGGTGTTGATTCCTGAGTTAGTGTTCATGTTGTG[T/A]CTTTTCGGGTACCTGGTCTTCATGGTGGTGTTTAAATGGATTGCGTTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5vxnsh1x