
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tcirg1
- Ensembl ID:
- ENSDARG00000016835
- ZFIN ID:
- ZDB-GENE-090311-31
- Description:
- Novel protein similar to H.sapiens ATPase, H+ transporting, lysosomal V0 subunit [Source:UniProtKB/T
- Human Orthologue:
- TCIRG1
- Human Description:
- T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3 [Source:HGNC Symbol;Acc
- Mouse Orthologue:
- Tcirg1
- Mouse Description:
- T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3 Gene [Source:MGI Symbol
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1773 | Nonsense | Confirmed mutation in F2 line | During 2018 |
Mutation Details
- Allele Name:
- sa1773
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000033405 | Nonsense | 581 | 823 | 15 | 20 |
ENSDART00000136419 | None | 117 | None | 3 | |
ENSDART00000145354 | Nonsense | 581 | 666 | 15 | 16 |
- Genomic Location (Zv9):
- Chromosome 1 (position 45340428)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 44183647 GRCz11 1 44884950 - KASP Assay ID:
- 554-1766.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGAGCAGTGTGTTCCTGGTGTTGATTCCTGAGTTAGTGTTCATGTTGTG[T/A]CTTTTCGGGTACCTGGTCTTCATGGTGGTGTTTAAATGGATTGCGTTTGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: