ccdc40

Ensembl ID:
ENSDARG00000016813
ZFIN ID:
ZDB-GENE-060503-723
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S566]
Human Orthologue:
CCDC40
Human Description:
coiled-coil domain containing 40 [Source:HGNC Symbol;Acc:26090]
Mouse Orthologue:
Ccdc40
Mouse Description:
coiled-coil domain containing 40 Gene [Source:MGI Symbol;Acc:MGI:2443893]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8996 Nonsense Mutation detected in F1 DNA During 2014
sa13373 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002617 Nonsense 314 941 8 19
ENSDART00000140156 None None 101 None 3
ENSDART00000145154 None None 261 None 5
Genomic Location:
Chromosome 6 (position 19639851)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCCTCTTAATGATGAAGAGGAGGGATGAGGCTTACACTGCCATGCAA[G/T]AGGAACTAAGGTAAACATAATGCTCATGATATCTGTGTGAATGACTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002617 Nonsense 427 941 10 19
ENSDART00000140156 None None 101 None 3
ENSDART00000145154 None None 261 None 5
Genomic Location:
Chromosome 6 (position 19639318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGAAGCAGATGGAGAAAGTGTCWGCAGTGCGTTTGGACCYAGAAAGC[C/T]AGATCATGAACAAATTGCAGGAGCAGCTTACTCACAATAATGCAGCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/blbaytx5