INT3_DANRE

Ensembl ID:
ENSDARG00000016811
Description:
Integrator complex subunit 3 [Source:UniProtKB/Swiss-Prot;Acc:Q1LXC9]
Human Orthologue:
INTS3
Human Description:
integrator complex subunit 3 [Source:HGNC Symbol;Acc:26153]
Mouse Orthologue:
Ints3
Mouse Description:
integrator complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2140050]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23531 Nonsense Mutation detected in F1 DNA During 2014
sa6559 Nonsense Mutation detected in F1 DNA During 2014
sa14360 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067793 Nonsense 272 1017 9 29
ENSDART00000124755 Nonsense 272 362 9 20
ENSDART00000130401 Nonsense 272 362 9 11
Genomic Location:
Chromosome 19 (position 27139537)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAATACTTTTTTTTTTTTCTTTTAGGTATATTGCAGCTCCTTACCTCT[A/T]GAACCTCACGAAAGTTTCTGGCCTGTCGACTCACCCCTGACATGGAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067793 Nonsense 576 1017 17 29
ENSDART00000124755 None None 362 None 20
ENSDART00000130401 None None 362 None 11
Genomic Location:
Chromosome 19 (position 27145721)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNTGGTCTTTCTCTCTCAGTGACACAGAAACACATTGTGAGGTCATG[C/T]AGGAAATTGTGGATCTCATTTTAGAGGTGATGTTTGCTCGTTGAAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067793 Nonsense 882 1017 25 29
ENSDART00000124755 None None 362 16 20
ENSDART00000130401 None None 362 None 11
Genomic Location:
Chromosome 19 (position 27155020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAACATATTAAAGCCCTGCTCATTAAGAACAACAACATGCCTCGCAAA[C/T]GACAGAGGTAATRGCAACCCTTGAGCTAGTTTAACGCCCTCTTGTGACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6rxipjtb