prkacab

Ensembl ID:
ENSDARG00000016809
ZFIN ID:
ZDB-GENE-040801-208
Description:
cAMP-dependent protein kinase catalytic subunit gamma [Source:RefSeq peptide;Acc:NP_001003470]
Human Orthologues:
PRKACA, PRKACG
Human Descriptions:
protein kinase, cAMP-dependent, catalytic, alpha [Source:HGNC Symbol;Acc:9380]
protein kinase, cAMP-dependent, catalytic, gamma [Source:HGNC Symbol;Acc:9382]
Mouse Orthologue:
Prkaca
Mouse Description:
protein kinase, cAMP dependent, catalytic, alpha Gene [Source:MGI Symbol;Acc:MGI:97592]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5943 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019936 Essential Splice Site 214 351 7 10
Genomic Location (Zv9):
Chromosome 1 (position 56487273)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55174283
KASP Assay ID:
554-3964.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGTGTGGGACCCCRGAGTATCTGGCTCCAGAGATCAKCCTCAGCAAG[G/A]TGAGAAGTGTGGTGTTACACCTGCGCTCGCAACAGTCACATAACGAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link