mtmr6

Ensembl ID:
ENSDARG00000016794
ZFIN ID:
ZDB-GENE-030131-5557
Description:
myotubularin-related protein 6 [Source:RefSeq peptide;Acc:NP_956085]
Human Orthologue:
MTMR6
Human Description:
myotubularin related protein 6 [Source:HGNC Symbol;Acc:7453]
Mouse Orthologue:
Mtmr6
Mouse Description:
myotubularin related protein 6 Gene [Source:MGI Symbol;Acc:MGI:2145637]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18593 Nonsense Available for shipment Available now
sa24510 Nonsense Mutation detected in F1 DNA During 2014
sa6770 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005845 Nonsense 309 643 8 14
Genomic Location:
Chromosome 24 (position 25657602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCCTTTCTATGACTGATTATCTGGTTGGACTGGAAAACAGCGGATGGT[T/A]GCGYCACATCAAAGCCATCATGGATGCAGCTATAWTCCTTGCCAAAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005845 Nonsense 411 643 11 14
Genomic Location:
Chromosome 24 (position 25660696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCCCCATCTTCACACAATTCCTTGAGTGTGTTTGGCAGCTGACGGAA[C/T]AGTTTCCTCAGGCTTTTGAGTTTAGCGAGTGGTTTCTCATTCAGATCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005845 Nonsense 497 643 13 14
Genomic Location:
Chromosome 24 (position 25662830)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTACTAAAAATGCTGTTTTTTGKTTTGTTTTGTTTTTGMAGGTTCTG[G/A]AGGAACATGTACCATCAGTATGACCGCTCCCTGCACCCTCGGCAGTCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uajh3vcw