si:ch211-159p3.1

Ensembl ID:
ENSDARG00000016788
ZFIN ID:
ZDB-GENE-070912-124
Description:
Novel protein similar to vertebrate zinc finger E-box binding homeobox 1 (ZEB1) [Source:UniProtKB/Tr
Human Orthologue:
ZEB1
Human Description:
zinc finger E-box binding homeobox 1 [Source:HGNC Symbol;Acc:11642]
Mouse Orthologue:
Zeb1
Mouse Description:
zinc finger E-box binding homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:1344313]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15743 Nonsense Available for shipment Available now
sa838 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15743
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005449 Nonsense 255 923 4 11
ENSDART00000132432   None 62 None 2
ENSDART00000136077   None 129 None 3
ENSDART00000146493 Nonsense 255 1101 4 7

The following transcripts of ENSDARG00000016788 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43879684)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43965185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRGCCACTCCTGCCATGGCTGCCACCACAACCAATGGAGTCGTGGCWCCG[C/T]AGAGCRTCCTCCAAACATTAGTCCTGCCYACAGTCGGGCTGGTCCAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005449 Nonsense 561 923 7 11
ENSDART00000132432   None 62 None 2
ENSDART00000136077   None 129 None 3
ENSDART00000146493 Nonsense 725 1101 5 7

The following transcripts of ENSDARG00000016788 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 43874639)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 43960140
KASP Assay ID:
554-0741.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTCCCAGTCCCACTCCTCCMCCTGACTCCAGCCCCTCAGAGGAGGAG[C/T]AGAACAKAAGCACTGCCTCCCCCGCGTCTCCACCAGCCAGTGTCTCCACY
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link