huwe1

Ensembl ID:
ENSDARG00000016782
ZFIN ID:
ZDB-GENE-081104-387
Human Orthologue:
HUWE1
Human Description:
HECT, UBA and WWE domain containing 1 [Source:HGNC Symbol;Acc:30892]
Mouse Orthologue:
Huwe1
Mouse Description:
HECT, UBA and WWE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1926884]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa618 Essential Splice Site Available for shipment Available now
sa15608 Essential Splice Site Available for shipment Available now
sa24357 Nonsense Mutation detected in F1 DNA During 2014
sa17915 Essential Splice Site Available for shipment Available now
sa8021 Nonsense Mutation detected in F1 DNA During 2014
sa5058 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24358 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 231 4569 7 80
ENSDART00000146990 Essential Splice Site 235 4474 7 79
Genomic Location:
Chromosome 23 (position 28740634)
KASP Assay ID:
554-0528.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAAGCAGTAATACGCTACACTACATTCATATCGAACAACTTGATAAGG[T/C]GAGTTTCTGGGGTTTACATTTGCTGTCCTTGTGGAACAGTTAATGGAAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 533 4569 14 80
ENSDART00000146990 Essential Splice Site 536 4474 14 79
Genomic Location:
Chromosome 23 (position 28746954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACCGATTCGCGAGCACARAGCAATGCATCCAGCACCCCAAGAGCAGG[T/C]AAAAAYACTNCCAARTACTCTAACTCACAWGTCAGTGGGTGTGYAGTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 957 4569 24 80
ENSDART00000146990 Nonsense 960 4474 24 79
Genomic Location:
Chromosome 23 (position 28753635)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCTCTTGCTCCTCCTTTCAGAGCGAGATTCGTGCTATCTCTGTGAAT[C/T]AATGGGGATCTCAACTGGGTCTTAGTGTTTTGAACAAACTGAGTCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 1437 4569 31 80
ENSDART00000146990 Essential Splice Site 1404 4474 31 79
Genomic Location:
Chromosome 23 (position 28758134)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTACCTGCTCACACACCCTCCACCACTGCTCAGCGCGGCTGTCAGAG[T/G]AAGACCCTAAYCAACACAGACAAAACCCTCWGTCTTTCTCCCATACACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 3942 4569 69 80
ENSDART00000146990 Nonsense 3866 4474 68 79
Genomic Location:
Chromosome 23 (position 28795030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCCATCATTCAGATGGTGAGAGAGGGACAGAGGGCACGCCGTCTACAG[C/T]AGGCCCCCCCACCCTCTTCATCTGCATCCTCTTCCNNNGCTGCTGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 4372 4569 76 80
ENSDART00000146990 Essential Splice Site 4296 4474 75 79
Genomic Location:
Chromosome 23 (position 28804751)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAACGATGTGTCGACTCTGGGCTAYGAGCTGACATTCAGCACAGAGG[T/C]ATAGGCTGCATTTTCATACCAATTACACCTWCTTATTGTGTTATTCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 4472 4569 78 80
ENSDART00000146990 Essential Splice Site 4396 4474 77 79
Genomic Location:
Chromosome 23 (position 28807193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAAGGCCAATACTGAATACCATAAATATCAGTCCAGTTCTATTCAGG[T/C]GTGTACACACACAATAGGATGACATGAAATAAAATATTTGATTGTTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y9spyxia