huwe1

Ensembl ID:
ENSDARG00000016782
ZFIN ID:
ZDB-GENE-081104-387
Human Orthologue:
HUWE1
Human Description:
HECT, UBA and WWE domain containing 1 [Source:HGNC Symbol;Acc:30892]
Mouse Orthologue:
Huwe1
Mouse Description:
HECT, UBA and WWE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1926884]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37738 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa618 Essential Splice Site Available for shipment Available now
sa37739 Nonsense Available for shipment Available now
sa15608 Essential Splice Site Available for shipment Available now
sa24357 Nonsense Available for shipment Available now
sa44001 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa17915 Essential Splice Site Available for shipment Available now
sa37740 Nonsense Mutation detected in F1 DNA During 2016
sa39413 Nonsense Mutation detected in F1 DNA During 2016
sa37741 Essential Splice Site Mutation detected in F1 DNA During 2016
sa44002 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24358 Essential Splice Site Available for shipment Available now
sa30743 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Splice Site, Nonsense 49 4569 3 80
ENSDART00000146990 Splice Site, Nonsense 53 4474 3 79
Genomic Location (Zv9):
Chromosome 23 (position 28737404)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28567971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATATGCATGTTCAGATCTTCATTGATGACCTGTTTCTCTTCCCAGTG[C/A]GAGTTGTATCATTGGGTGGACTTGCTGGACCGCTTTGATGGCATCCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 231 4569 7 80
ENSDART00000146990 Essential Splice Site 235 4474 7 79
Genomic Location (Zv9):
Chromosome 23 (position 28740634)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28571201
KASP Assay ID:
554-0528.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAAGCAGTAATACGCTACACTACATTCATATCGAACAACTTGATAAGG[T/C]GAGTTTCTGGGGTTTACATTTGCTGTCCTTGTGGAACAGTTAATGGAAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa37739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 423 4569 12 80
ENSDART00000146990 Nonsense 426 4474 12 79
Genomic Location (Zv9):
Chromosome 23 (position 28743691)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28574258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAACCTATGCCACTTTCACATCAGGTGATCAAGTTCCTAGGGGACGAG[C/T]AGGACCAGATTACCTTTGTGACGCGGGCAGTGAGAGTTGTGGATCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 533 4569 14 80
ENSDART00000146990 Essential Splice Site 536 4474 14 79
Genomic Location (Zv9):
Chromosome 23 (position 28746954)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28577521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACCGATTCGCGAGCACARAGCAATGCATCCAGCACCCCAAGAGCAGG[T/C]AAAAAYACTNCCAARTACTCTAACTCACAWGTCAGTGGGTGTGYAGTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 957 4569 24 80
ENSDART00000146990 Nonsense 960 4474 24 79
Genomic Location (Zv9):
Chromosome 23 (position 28753635)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28584202
KASP Assay ID:
2261-7913.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCTCTTGCTCCTCCTTTCAGAGCGAGATTCGTGCTATCTCTGTGAAT[C/T]AATGGGGATCTCAACTGGGTCTTAGTGTTTTGAACAAACTGAGTCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Splice Site, Nonsense 1396 4569 30 80
ENSDART00000146990   None 4474 None 79
Genomic Location (Zv9):
Chromosome 23 (position 28757769)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28588336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTACTACAGCACGCAGAGAGCCACAGGTCAACCAAGCTCAGCTCACA[C/T]AGGTATGTCACTTCCTGTTATTAGATATTCCTGCTGCATTTAAATTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 1437 4569 31 80
ENSDART00000146990 Essential Splice Site 1404 4474 31 79
Genomic Location (Zv9):
Chromosome 23 (position 28758134)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28588701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTACCTGCTCACACACCCTCCACCACTGCTCAGCGCGGCTGTCAGAG[T/G]AAGACCCTAAYCAACACAGACAAAACCCTCWGTCTTTCTCCCATACACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 2745 4569 55 80
ENSDART00000146990   None 4474 None 79
Genomic Location (Zv9):
Chromosome 23 (position 28776635)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28607202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGACAGATGAGTGTAAAGTGCTGGATGCTGAGAGCATGCATGACTG[T/A]GTGGCAGGTGAGATCATCTCAGAACGAATATATGATAGCATCTGTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Nonsense 3412 4569 63 80
ENSDART00000146990 Nonsense 3336 4474 62 79
Genomic Location (Zv9):
Chromosome 23 (position 28784672)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28615239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCAATGGACGCAGCTCTTGGATGCAGAACCAACATCTTTCAGATCCAG[C/T]GAGTATCAGGCAGGAAACACGCAGAGAGGCATTCAGCAGGAGGGAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37741
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 4023 4569 70 80
ENSDART00000146990 Essential Splice Site 3947 4474 69 79
Genomic Location (Zv9):
Chromosome 23 (position 28797768)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28628335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGATGTGGATCAGCCCTCTCCTTTGGAACAGGACCAGCCAACATTAGG[T/C]GAGTGTCTGGGAATATAGGACAACCTAACAATAGGAACGTCACTGGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 4472 4569 78 80
ENSDART00000146990 Essential Splice Site 4396 4474 77 79
Genomic Location (Zv9):
Chromosome 23 (position 28807192)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28637759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCAAGGCCAATACTGAATACCATAAATATCAGTCCAGTTCTATTCAG[G/A]TGTGTACACACACAATAGGATGACATGAAATAAAATATTTGATTGTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 4472 4569 78 80
ENSDART00000146990 Essential Splice Site 4396 4474 77 79
Genomic Location (Zv9):
Chromosome 23 (position 28807193)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28637760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAAGGCCAATACTGAATACCATAAATATCAGTCCAGTTCTATTCAGG[T/C]GTGTACACACACAATAGGATGACATGAAATAAAATATTTGATTGTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006657 Essential Splice Site 4536 4569 79 80
ENSDART00000146990 Essential Splice Site 4460 4474 None 79
Genomic Location (Zv9):
Chromosome 23 (position 28808902)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28639469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCACCGAGATGACCGCTCCACTGACCGCCTGCCCTCTGCGCACACTTG[G/T]TAAATGCTCATATATTAATGATGTGCCTTTTAAAACAAACAATTCAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link