tfa

Ensembl ID:
ENSDARG00000016771
ZFIN ID:
ZDB-GENE-980526-35
Description:
transferrin-a [Source:RefSeq peptide;Acc:NP_001015057]
Human Orthologues:
LTF, TF
Human Descriptions:
lactotransferrin [Source:HGNC Symbol;Acc:6720]
transferrin [Source:HGNC Symbol;Acc:11740]
Mouse Orthologues:
1300017J02Rik, Ltf, RP24-421P3.2, Trf
Mouse Descriptions:
lactotransferrin Gene [Source:MGI Symbol;Acc:MGI:96837]
RIKEN cDNA 1300017J02 gene Gene [Source:MGI Symbol;Acc:MGI:1919025]
signal recognition particle receptor subunit beta [Source:RefSeq peptide;Acc:NP_033301]
transferrin Gene [Source:MGI Symbol;Acc:MGI:98821]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19720 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12059 Nonsense Available for shipment Available now
sa15651 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003845 Essential Splice Site 204 675 5 17
ENSDART00000108611 Essential Splice Site 204 673 5 17
ENSDART00000124119 Essential Splice Site 214 286 4 6
ENSDART00000125647 Essential Splice Site 205 674 6 18
ENSDART00000127207 None None 169 None 9
Genomic Location:
Chromosome 2 (position 16589940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCTGCTCACACAACGAGAAGTACTTCGGTGATGACGGAGCCTTCCAG[T/C]ATGAGCCACACTAATACAATCCCTTATATAAGTATACACCAAGTTCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003845 Nonsense 267 675 7 17
ENSDART00000108611 Nonsense 267 673 7 17
ENSDART00000124119 Nonsense 277 286 6 6
ENSDART00000125647 Nonsense 268 674 8 18
ENSDART00000127207 None None 169 None 9
Genomic Location:
Chromosome 2 (position 16587983)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAGCCTGCCCGCACTGTCATTGCTCGCACCGATACTGATTTACAATA[T/A]GTTTATGATGTCCTGAAGCAGATTCCGGTATGCCCTTACAGTGTCACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003845 Essential Splice Site 608 675 16 17
ENSDART00000108611 Essential Splice Site 606 673 16 17
ENSDART00000124119 None None 286 None 6
ENSDART00000125647 Essential Splice Site 607 674 17 18
ENSDART00000127207 None None 169 None 9
Genomic Location:
Chromosome 2 (position 16581925)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATGTCTTACAAATAAAGTTTTAAATCCCATCTCTTATCATATGTTTC[A/T]GAGCAAAAATAATGACCTTTTCACCTCCAAAGATGGGAAAAATCTCCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3ukscrl6