sgta

Ensembl ID:
ENSDARG00000016769
ZFIN ID:
ZDB-GENE-040704-72
Description:
small glutamine-rich tetratricopeptide repeat-containing protein beta [Source:RefSeq peptide;Acc:NP
Human Orthologue:
SGTB
Human Description:
small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta [Source:HGNC Symbol;Acc:23567]
Mouse Orthologue:
Sgtb
Mouse Description:
small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41607 Nonsense Mutation detected in F1 DNA During 2017
sa34864 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020665 Nonsense 160 320 6 12
Genomic Location (Zv9):
Chromosome 10 (position 15428615)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15441922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCACATAGTAAACTTGAAAACTACACAGAGGCAATGGGAGACTGTGAA[C/T]GAGCGATTGCGATCGACCCATCGTACAGTAAAGCTTATGGCAGAATGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020665 Nonsense 216 320 7 12
Genomic Location (Zv9):
Chromosome 10 (position 15427140)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15440447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTGAAAACGACACTTACAAATCCAACCTAAAGATTGTGGAGCAGAAA[C/T]AAAAAGAAGCCTCCAGCCCGGTGAGTAGAAACAGCTGCTTTCAGAATCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link