ABCC6 (2 of 3)

Ensembl ID:
ENSDARG00000016750
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Source:HGNC Symbol;Acc:57]
Human Orthologue:
ABCC6
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Source:HGNC Symbol;Acc:57]
Mouse Orthologue:
Abcc6
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 Gene [Source:MGI Symbol;Acc:MGI:1351634]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33821 Nonsense Mutation detected in F1 DNA During 2016
sa963 Essential Splice Site Available for shipment Available now
sa2285 Nonsense F2 line generated During 2016
sa40643 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31502 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065433 Nonsense 447 1507 10 31
Genomic Location (Zv9):
Chromosome 6 (position 10959520)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10813146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTGTGGCTGGCACCCATTGAGGTCACACTCTGTCTCTTTTTTCTTTG[G/A]CAGGTGAGGGCTCATTTATTTGCTATTATAATATCTCAGTATTCGGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065433 Essential Splice Site 750 1507 17 31
Genomic Location (Zv9):
Chromosome 6 (position 10964178)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10817804
KASP Assay ID:
554-0868.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATCTGGACAATCTACCTGCAGGAGATGCCACTGAGATTGGAGAGAAG[G/A]TGAGACACCTATGCTTTACCCAAAGTAGAGTAATGAGCTAAAGTTATATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa2285
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065433 Nonsense 758 1507 18 31
Genomic Location (Zv9):
Chromosome 6 (position 10965677)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10819303
KASP Assay ID:
554-2533.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAATCATRARCAAAATTGTTTTGCCAGGGTTTAAATTTGTCTGGAGGA[C/T]AGAAACAGAGGGTGAGCCTGGCACGYGCTGTTTACAGGAAAGGTGACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065433 Essential Splice Site 897 1507 20 31
Genomic Location (Zv9):
Chromosome 6 (position 10966367)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10819993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGACTACATGCCGTTTTCGAGGGATCTATCTCAAGAGCAGTTAATCGG[G/C]TATGGAATTTTATATTTGCTAATGCATTGCTAACAAACACTTTAATGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065433 Nonsense 971 1507 22 31
Genomic Location (Zv9):
Chromosome 6 (position 10967284)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10820910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTTCTCTACGCCTTCCAACAAGCAGCGTCTCTGTCAAATAATTACTG[G/A]TTGAGCTTGTGGGCCGACCAGCCTGTGATCAACGGCACTCAATTAAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link