ABCC6 (2 of 3)

Ensembl ID:
ENSDARG00000016750
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Source:HGNC Symbol;Acc:57]
Human Orthologue:
ABCC6
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Source:HGNC Symbol;Acc:57]
Mouse Orthologue:
Abcc6
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 Gene [Source:MGI Symbol;Acc:MGI:1351634]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5353 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa963 Essential Splice Site Available for shipment Available now
sa2285 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065433 Splice Site, Nonsense 223 1507 7 31
Genomic Location:
Chromosome 6 (position 10955897)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAGTGAAAGTAATACATATTCAGTCTGTATTTTCTGTGCTTSCAGGT[T/G]AATATTTAAAGGATACCGTTCTCCTCTGCAAGCAGAAGATTTGTGGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065433 Essential Splice Site 750 1507 17 31
Genomic Location:
Chromosome 6 (position 10964178)
KASP Assay ID:
554-0868.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATCTGGACAATCTACCTGCAGGAGATGCCACTGAGATTGGAGAGAAG[G/A]TGAGACACCTATGCTTTACCCAAAGTAGAGTAATGAGCTAAAGTTATATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa2285
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065433 Nonsense 758 1507 18 31
Genomic Location:
Chromosome 6 (position 10965677)
KASP Assay ID:
554-2533.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAATCATRARCAAAATTGTTTTGCCAGGGTTTAAATTTGTCTGGAGGA[C/T]AGAAACAGAGGGTGAGCCTGGCACGYGCTGTTTACAGGAAAGGTGACGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xwjox9h6