fbn2b

Ensembl ID:
ENSDARG00000016744
ZFIN ID:
ZDB-GENE-090112-3
Description:
fibrillin-2 [Source:RefSeq peptide;Acc:NP_001129262]
Human Orthologue:
FBN3
Human Description:
fibrillin 3 [Source:HGNC Symbol;Acc:18794]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13470 Nonsense Available for shipment Available now
sa16275 Essential Splice Site Available for shipment Available now
sa24062 Nonsense Available for shipment Available now
sa12625 Essential Splice Site Available for shipment Available now
sa43757 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008681 Nonsense 152 1862 4 42
Genomic Location (Zv9):
Chromosome 22 (position 4001730)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4109072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGCGACTGTCCTCCAGGACACCAGCTCAGTACTGAGGCCTCTGCTTG[T/A]GAAGGTACAGTATAGTGTTTGTSTTTGTGTGAAGCTGACNTTTTGGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008681 Essential Splice Site 196 1862 6 42
Genomic Location (Zv9):
Chromosome 22 (position 4003474)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4107328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGAATTGTGTATATATAAACGGGTAAATTTGTATCTCTTGACGCCTCC[A/C]GATATCGACGAGTGCACCATCATGAACGGYGGCTGCGACACACACTGMAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008681 Nonsense 759 1862 19 42
Genomic Location (Zv9):
Chromosome 22 (position 4015574)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4095228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGTGTGGTAATCAGGCTCCTGGTTTCATCATCGACATCCACACTGGA[A/T]AACCCATCGGTGAGTCCACTTAATAATGATGATAATAATAATACTTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008681 Essential Splice Site 927 1862 23 42
Genomic Location (Zv9):
Chromosome 22 (position 4018025)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4092777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGTGCTTCCCCGGGTTCGAGCTCACACATAATAATGACTGCATGGG[T/A]AAGACTATATGCTTTCAGGCCTATTWTAAATRATGCATTTACWGAGAART
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008681 Essential Splice Site 1485 1862 36 42
Genomic Location (Zv9):
Chromosome 22 (position 4033552)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4077250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTGTCCCAGAGGATACATCCTACAGCCGGATGGCAAGACCTGCAAAG[G/A]TTAGTTCACAATTTAAGGCTCATGATGCCATTTCATGTTTTCCGTTGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link