sc:d0316

Ensembl ID:
ENSDARG00000016739
ZFIN ID:
ZDB-GENE-080327-5
Description:
cDNA, clone cssl:d0316 [Source:UniProtKB/TrEMBL;Acc:A8BAU2]
Human Orthologue:
LRRC4C
Human Description:
leucine rich repeat containing 4C [Source:HGNC Symbol;Acc:29317]
Mouse Orthologue:
Lrrc4c
Mouse Description:
leucine rich repeat containing 4C Gene [Source:MGI Symbol;Acc:MGI:2442636]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41005 Nonsense Mutation detected in F1 DNA During 2017
sa238 Nonsense Confirmed mutation in F2 line During 2017
sa38639 Nonsense Mutation detected in F1 DNA During 2017
sa34176 Nonsense Mutation detected in F1 DNA During 2017
sa21060 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021605 Nonsense 23 631 1 1
Genomic Location (Zv9):
Chromosome 7 (position 51566295)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49836531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCCATCAGCGCCAGATGTTGAGAGGTCCTAGATGGAAAGGGGCTTG[G/A]TTTGACCCCTTGTTTCTCCTGCTTTTAGCCCTGCAGTTGCTTGTTGTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa238
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021605 Nonsense 155 631 1 1
Genomic Location (Zv9):
Chromosome 7 (position 51566691)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49836927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATCCCCAATGGCGCCTTTGAGTACCTATCTAAACTAAAAGAGCTGTG[G/A]CTTAGGAATAACCCTATCGAGAGCATACCGTCTGATGCCTTCAGTCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021605 Nonsense 236 631 1 1
Genomic Location (Zv9):
Chromosome 7 (position 51566932)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49837168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTCGCCTGGATGAGCTGGAGATGTCCGGGAATCAACTCACTGTCATC[C/T]AGCCCAGCTCTTTTAAGGGTCTTGTTCATCTCCAGAAGCTGTGGATGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021605 Nonsense 616 631 1 1
Genomic Location (Zv9):
Chromosome 7 (position 51568073)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49838309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACCACGTGTCTGCTCTCAGCTCGCTGCATAGTTCAGTGCATGAACCTT[T/A]ACTAATCCAAGCCAGCTCAAAGGATAACGTACAGGAGACGCAAATTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021605 Nonsense 622 631 1 1
Genomic Location (Zv9):
Chromosome 7 (position 51568091)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 49838327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTCGCTGCATAGTTCAGTGCATGAACCTTTACTAATCCAAGCCAGCT[C/A]AAAGGATAACGTACAGGAGACGCAAATTTGACCACGTTGGGTGAAACGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Osteoporosis: An integration of genome-wide association study and gene expression profiling to prioritize the discovery of novel susceptibility Loci for osteoporosis-related traits. (View Study)
  • Temperament (bipolar disorder): Genome-wide association study of temperament in bipolar disorder reveals significant associations with three novel Loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link