bcan

Ensembl ID:
ENSDARG00000016736
ZFIN ID:
ZDB-GENE-030131-6045
Description:
brevican core protein [Source:RefSeq peptide;Acc:NP_001077282]
Human Orthologue:
BCAN
Human Description:
brevican [Source:HGNC Symbol;Acc:23059]
Mouse Orthologue:
Bcan
Mouse Description:
brevican Gene [Source:MGI Symbol;Acc:MGI:1096385]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4666 Nonsense Mutation detected in F1 DNA During 2014
sa1944 Essential Splice Site, Splice Site Available for shipment Available now
sa10253 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047499 Nonsense 254 1300 5 14
ENSDART00000130700 Nonsense 96 191 2 5
Genomic Location:
Chromosome 16 (position 31553396)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTAACTAYGGCACGATGGAGAACGAYGAACTCTATGACGTATATTGCTA[T/A]GTGGAGAACATTCATGGTAAAYAATTAGCTGCTAATNNNGTTACGCTTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047499 Splice Site None 1300 None 14
ENSDART00000130700 Essential Splice Site 103 191 2 5
Genomic Location:
Chromosome 16 (position 31553374)
KASP Assay ID:
554-1932.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAYGAACTCTATGACGTATATTGCTATGTGGAGAACATTCATGGTAAA[C/T]AATTAGCTGCTAATNNNGTTACGCTTGAAAAACAGTACTCTTGACTGTACGCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047499 None None 1300 None 14
ENSDART00000130700 Nonsense 107 191 3 5
Genomic Location:
Chromosome 16 (position 31553287)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTWGACTGTACGCCAAAACTAGCATTTCAWATTTGWATTAGATTATTTWC[A/T]GAGAATGCAGGGTGCAGTNWGATTGTCAGTTTTTCCAAAGCAAGAAAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ac2fu6oy