psat1

Ensembl ID:
ENSDARG00000016733
ZFIN ID:
ZDB-GENE-030131-5723
Description:
phosphoserine aminotransferase isoform 1 [Source:RefSeq peptide;Acc:NP_956113]
Human Orthologue:
PSAT1
Human Description:
phosphoserine aminotransferase 1 [Source:HGNC Symbol;Acc:19129]
Mouse Orthologue:
Psat1
Mouse Description:
phosphoserine aminotransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2183441]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33776 Nonsense Mutation detected in F1 DNA During 2017
sa40607 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023983 Nonsense 5 368 1 9
Genomic Location (Zv9):
Chromosome 5 (position 72365749)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68727081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATCTCACGGACGAACGAGACGGTTTTATTTACAACATGGAGAAGAAA[C/T]AAACCGTTAATTTTGGGGCAGGACCCGCTAAACTCCCACAGTCGGTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023983 Nonsense 237 368 6 9
Genomic Location (Zv9):
Chromosome 5 (position 72358003)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68719335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGAATGCCCAATTATTCTGGACTATCAGGTGCAGGCTGGCAATAACT[C/A]GCTCTACAACACGCCTCCATGCTTCAGGTGCGGCTCCTCATTCTCCTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link