mmp11b

Ensembl ID:
ENSDARG00000016718
ZFIN ID:
ZDB-GENE-070817-2
Human Orthologue:
MMP11
Human Description:
matrix metallopeptidase 11 (stromelysin 3) [Source:HGNC Symbol;Acc:7157]
Mouse Orthologue:
Mmp11
Mouse Description:
matrix metallopeptidase 11 Gene [Source:MGI Symbol;Acc:MGI:97008]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11861 Nonsense Available for shipment Available now
sa23891 Nonsense Mutation detected in F1 DNA During 2014
sa14306 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010160 Nonsense 36 506 2 8
ENSDART00000136666 Nonsense 59 529 2 8
Genomic Location:
Chromosome 21 (position 13865264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAARTMTGCATGTGATTGACAGCTTMTGTGTGTGTGTTGACAGGACTG[G/A]CCTCAGAAGACCCATCACCATGGCCTCAAGAAGCGGGGTCGACTTCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010160 Nonsense 389 506 7 8
ENSDART00000136666 Nonsense 412 529 7 8
Genomic Location:
Chromosome 21 (position 13841982)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACTTTTCCCCATCTAGGCCAGAATTACTGGGTGTTTGATGCAGAGCGG[C/T]AGATCACAGGGCCAGACTCTGTACAGCGACTGGGACTATTGGTGAACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010160 Nonsense 491 506 8 8
ENSDART00000136666 Nonsense 514 529 8 8
Genomic Location:
Chromosome 21 (position 13839658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTACTGGAAGTTTGACCCAGTGGAGGTGAGGGTGCTGGAGGGATACCCA[C/T]GATACATCGGCGTGGATTTCTTTGGTTGTTCTGCAGCCTTGTATCGATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/20tq6k61