atic

Ensembl ID:
ENSDARG00000016706
ZFIN ID:
ZDB-GENE-011212-4
Description:
bifunctional purine biosynthesis protein PURH [Source:RefSeq peptide;Acc:NP_001076265]
Human Orthologue:
ATIC
Human Description:
5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase [Source:HGNC Symb
Mouse Orthologue:
Atic
Mouse Description:
5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase Gene [Source:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19406 Nonsense Mutation detected in F1 DNA During 2014
sa4826 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa19406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022307 Nonsense 184 590 6 15

The following transcripts of ENSDARG00000016706 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 4384347)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGAATTTGTATTTGTAATTCGTCAGGCCTTCACGCACACCGCTCAGTA[C/A]GACGAGGCCATCTCTGATTACTTCAGACGTGAATACAGTCGAGGAGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4826
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022307 Nonsense 464 590 13 15

The following transcripts of ENSDARG00000016706 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 4389966)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCGTATCCACTGCACCCGGCTGGCAGGAGACAAGGCTGATAACTGGTG[G/A]CTCAGGCACCATCCAGGAGTGCTCAGTATGAGGTTCCGCRGCGGAGTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f1jbau13