trpa1a

Ensembl ID:
ENSDARG00000016699
ZFIN ID:
ZDB-GENE-050105-6
Description:
transient receptor potential cation channel, subfamily A, member 1a [Source:RefSeq peptide;Acc:NP_0
Human Orthologue:
TRPA1
Human Description:
transient receptor potential cation channel, subfamily A, member 1 [Source:HGNC Symbol;Acc:497]
Mouse Orthologue:
Trpa1
Mouse Description:
transient receptor potential cation channel, subfamily A, member 1 Gene [Source:MGI Symbol;Acc:MGI:3

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu2163 Nonsense Confirmed mutation in F2 line Unknown
sa8995 Nonsense Mutation detected in F1 DNA During 2014
sa19784 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu2163
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004407 Nonsense 141 1115 4 28
ENSDART00000141906 Nonsense 152 1126 4 28
Genomic Location:
Chromosome 2 (position 29846957)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCAACAACAGCCACCAGGCACCCATTCATATGGCAGTCAGTCTGGGC[A/T]AAAACTTTGTCTTAGAGGTGGGTCAATCTCATCTTTTTTCTGCAAACACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa8995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004407 Nonsense 401 1115 12 28
ENSDART00000141906 Nonsense 412 1126 12 28
Genomic Location:
Chromosome 2 (position 29843006)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTACTGTTTACTGACAGGCTGTTGTTTTGTYTTCAGCATGAGAGTGTA[C/T]GAGAGCTGCTTAATGATGAGGATATTGAGGGCTGTACGCCTCTCCATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004407 Nonsense 890 1115 23 28
ENSDART00000141906 Nonsense 901 1126 23 28
Genomic Location:
Chromosome 2 (position 29836417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACCTGATATTGGGATTTGCTTTGTCCTTCTATGCCTTGATGATCGAA[C/T]AGGTGAGTATAGTGATTGTAAAAGACTGTGTACATATTTAATTTGCAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hqsu2csy