p2rx1

Ensembl ID:
ENSDARG00000016695
ZFIN ID:
ZDB-GENE-030319-1
Description:
P2X purinoceptor 1 [Source:RefSeq peptide;Acc:NP_945333]
Human Orthologue:
P2RX1
Human Description:
purinergic receptor P2X, ligand-gated ion channel, 1 [Source:HGNC Symbol;Acc:8533]
Mouse Orthologue:
P2rx1
Mouse Description:
purinergic receptor P2X, ligand-gated ion channel, 1 Gene [Source:MGI Symbol;Acc:MGI:1098235]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2222 Nonsense F2 line generated During 2017
sa20456 Nonsense Available for shipment Available now
sa20455 Nonsense Available for shipment Available now
sa12106 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2222
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002866 Nonsense 128 398 4 13
ENSDART00000130843 Nonsense 121 366 4 12
Genomic Location (Zv9):
Chromosome 5 (position 33089479)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30851711
KASP Assay ID:
554-2787.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAAAGTTGGATTCTCTTGYGTGTGTTTCAGCTGCCGGATGGGAAGAAC[A/T]AGTGCACYAATGACTCAGACTGTGATGACAGCAAATACAAACGTACGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002866 Nonsense 231 398 7 13
ENSDART00000130843 Nonsense 200 366 7 12
Genomic Location (Zv9):
Chromosome 5 (position 33085150)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30847382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATAACTGTGTGTATCACCCCAAAACTGCTCCGCTGTGTCCTATCTTC[A/T]GACTGGGTGACATTGTTGAGCGATCCGGGTTCAGTTTCTCAGAAATAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002866 Nonsense 274 398 8 13
ENSDART00000130843 Nonsense 243 366 8 12
Genomic Location (Zv9):
Chromosome 5 (position 33084139)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30846371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGGGACTGCAATCTGGACCTGAGTATCAGATTCTGCAAACCAAAATA[T/G]GAGTTCTATGGTCTTTATGGAACTGGGAAAAACGACCAAGTAGATAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002866 Essential Splice Site 298 398 9 13
ENSDART00000130843 Essential Splice Site 267 366 9 12
Genomic Location (Zv9):
Chromosome 5 (position 33083748)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30845980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGGATTCAGYCCTAGANCTACAGTGTTATGTRYTTCTGGCTGTTTC[A/T]GATTTGCTAAATATTATGTGGAGAATAGYGTGCAGAAGAGAAMACTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link