cd9b

Ensembl ID:
ENSDARG00000016691
ZFIN ID:
ZDB-GENE-040426-2768
Description:
CD9 antigen, b [Source:RefSeq peptide;Acc:NP_998593]
Human Orthologue:
CD9
Human Description:
CD9 molecule [Source:HGNC Symbol;Acc:1709]
Mouse Orthologue:
Cd9
Mouse Description:
CD9 antigen Gene [Source:MGI Symbol;Acc:MGI:88348]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5242 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026559 Nonsense 12 231 1 8
ENSDART00000103316 None None 224 None 8
ENSDART00000103319 None None 227 None 8
ENSDART00000135352 None None 160 None 8
ENSDART00000147804 None None 221 None 6
Genomic Location:
Chromosome 4 (position 4131397)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACGGATCTATCTACATGATRTCTAAATCAGGTCTGTCCAGTGGRGAG[C/T]AATGCATCAAATACATCATATTCTTCTTTAATTTCATGYTATGGGTAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oak4xpi0