acadvl

Ensembl ID:
ENSDARG00000016687
ZFIN ID:
ZDB-GENE-030131-899
Description:
very long-chain specific acyl-CoA dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_997776
Human Orthologue:
ACADVL
Human Description:
acyl-CoA dehydrogenase, very long chain [Source:HGNC Symbol;Acc:92]
Mouse Orthologue:
Acadvl
Mouse Description:
acyl-Coenzyme A dehydrogenase, very long chain Gene [Source:MGI Symbol;Acc:MGI:895149]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20905 Nonsense Mutation detected in F1 DNA During 2014
sa2360 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa20905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023089 Nonsense 304 659 11 21
ENSDART00000131019 Nonsense 304 659 10 20
ENSDART00000143030 None None 179 None 7
Genomic Location:
Chromosome 7 (position 21468478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCATATTCACCTTAATTAATACTCTCTTTCAGTGGTCCTCCTGAGAAA[A/T]AGATGGGCATTAAAGCGTCCAACACCGCAGAAGTGTATTTTGAGAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2360
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023089 Essential Splice Site 565 659 19 21
ENSDART00000131019 Essential Splice Site 565 659 18 20
ENSDART00000143030 None None 179 None 7
Genomic Location:
Chromosome 7 (position 21485961)
KASP Assay ID:
554-2839.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCACCTTTGCCTGTGGTAATTGTGTGATTTCTGTATGTTTTTCTCTTT[A/C]GATGAACAATTTGTTCTGAAGCGAGTTGCTGACTGTGCCATTGATCTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s7ma7rlm