gabbr1b

Ensembl ID:
ENSDARG00000016667
ZFIN ID:
ZDB-GENE-060503-5
Description:
Novel protein similar to vertebrate gamma-aminobutyric acid (GABA) B receptor, 1 (GABBR1) [Source:Un
Human Orthologue:
GABBR1
Human Description:
gamma-aminobutyric acid (GABA) B receptor, 1 [Source:HGNC Symbol;Acc:4070]
Mouse Orthologue:
Gabbr1
Mouse Description:
gamma-aminobutyric acid (GABA) B receptor, 1 Gene [Source:MGI Symbol;Acc:MGI:1860139]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36851 Nonsense Mutation detected in F1 DNA During 2017
sa6561 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045616 Nonsense 601 994 15 24
ENSDART00000143919 Nonsense 388 778 10 18
Genomic Location (Zv9):
Chromosome 19 (position 27563514)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27493626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACAGAAACTCTTCGTCTCTGTGTCTGTTTTCGCTGGCTTGGGCATTT[T/A]AATGGGGATTGTTTGCCTCACCTTTAACATCTACAACAGCAATGTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045616 Essential Splice Site 811 994 20 24
ENSDART00000143919 Essential Splice Site 598 778 15 18
Genomic Location (Zv9):
Chromosome 19 (position 27540195)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27470307
KASP Assay ID:
554-5074.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAATTAACGATCATSGAGCTGTTGGGATGGCCATCTACAACGTCTCGG[T/C]GAGTCTGTTCGTCTTTTTAAACTTTACCCTGCGGATTTTTAAAGAGCACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link