Q7SYN2_DANRE

Ensembl ID:
ENSDARG00000016664
Description:
LOC402838 protein [Source:UniProtKB/TrEMBL;Acc:Q7SYN2]
Human Orthologue:
RNF20
Human Description:
ring finger protein 20 [Source:HGNC Symbol;Acc:10062]
Mouse Orthologue:
Rnf20
Mouse Description:
ring finger protein 20 Gene [Source:MGI Symbol;Acc:MGI:1925927]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12467 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027733   None 605 None 15
ENSDART00000125309 Essential Splice Site 873 1013 18 21
Genomic Location (Zv9):
Chromosome 14 (position 22072124)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20773612
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGAGCTGGGGYTTCGCACGCAGGCATTAGAGATGAACAAACGCAAGG[T/C]ACTGCAACAAACAGTAAATGTCATGGAGGTTATCTACAGCTNNTCTTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link