si:ch211-283f6.8

Ensembl ID:
ENSDARG00000016651
ZFIN ID:
ZDB-GENE-030219-199
Description:
Zgc:100799 [Source:UniProtKB/TrEMBL;Acc:Q6DGE8]
Human Orthologue:
ZFP106
Human Description:
zinc finger protein 106 homolog (mouse) [Source:HGNC Symbol;Acc:23240]
Mouse Orthologue:
Zfp106
Mouse Description:
zinc finger protein 106 Gene [Source:MGI Symbol;Acc:MGI:1270153]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14610 Nonsense Available for shipment Available now
sa28922 Nonsense Mutation detected in F1 DNA During 2017
sa36514 Nonsense Mutation detected in F1 DNA During 2017
sa36513 Nonsense Mutation detected in F1 DNA During 2017
sa36512 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Nonsense 28 1636 2 21
ENSDART00000132969   None 382 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 45537449)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45386681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGMCRTGTCCTATTTTTTTAGGAGAYGGAAGAGCACATGAGAAGTATGT[T/A]GCACCACCGAGAGCTRGAGAATCTGAAAGGCCGGTAAGAGGAAWTGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Nonsense 127 1636 4 21
ENSDART00000132969   None 382 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 45533364)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45382596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAACAGGCTAAAGAAGAGCAAGAAAATATAAGAAAGTGGCAGGAACTT[C/T]GAACAAGAAATATGATGTATCAGCCCTGTGGCCCTTGGGACCGGCCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Nonsense 133 1636 4 21
ENSDART00000132969   None 382 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 45533344)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45382576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAAAATATAAGAAAGTGGCAGGAACTTCGAACAAGAAATATGATGTA[T/A]CAGCCCTGTGGCCCTTGGGACCGGCCATATTCTAACTTTCCGCAGATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Nonsense 430 1636 4 21
ENSDART00000132969   None 382 None 11
Genomic Location (Zv9):
Chromosome 17 (position 45532455)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45381687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTAGCTCTAAAAGTTCTAAGCATTCACATTCAAGCTCAGAAATCCCA[C/T]AACATGGTTCGTCCAGTGCACAGCAAGACAGACTGCTTTCGGAGATGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112075 Nonsense 1157 1636 10 21
ENSDART00000132969   None 382 None 11
Genomic Location (Zv9):
Chromosome 17 (position 45529587)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 45378819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGAAGGATAAGAATGAGGAGATGGTAGTGACTGAAGCTTCAAAGCCA[C/T]AACCACAGGGAATAAAGCTCGCCAAACCACCGTTGAATGAAGCCAATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link