sec23a

Ensembl ID:
ENSDARG00000016636
ZFIN ID:
ZDB-GENE-040426-2823
Description:
Protein transport protein Sec23A [Source:UniProtKB/Swiss-Prot;Acc:Q7SZE5]
Human Orthologue:
SEC23A
Human Description:
Sec23 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:10701]
Mouse Orthologue:
Sec23a
Mouse Description:
SEC23A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1349635]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6460 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa6460
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003246 Nonsense 98 765 4 21
ENSDART00000145617 Nonsense 98 765 4 20
Genomic Location (Zv9):
Chromosome 17 (position 10505810)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9939514
KASP Assay ID:
554-4554.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATATTGTTAAACAATATCCCTGTGCTTTTATAGTTCCCACCAACCTA[T/A]GCTGGRATATCTGAAGKCAACCAGCCTGCTGAGCTACTTCCACAGTTTTC
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Entity Quality Tag
Larval:Day 5
ZFS:0000037
cranium
ZFA:0000737

malformed
PATO:0000646
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
pectoral fin
ZFA:0001161

malformed
PATO:0000646
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076

aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
anterior/posterior axis
BSPO:0000013
decreased length
PATO:0000574
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084

quality
PATO:0000001
abnormal
PATO:0000460

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link