tprb

Ensembl ID:
ENSDARG00000016630
ZFIN ID:
ZDB-GENE-030131-6410
Description:
nucleoprotein TPR [Source:RefSeq peptide;Acc:NP_001025294]
Human Orthologue:
TPR
Human Description:
translocated promoter region (to activated MET oncogene) [Source:HGNC Symbol;Acc:12017]
Mouse Orthologue:
Tpr
Mouse Description:
translocated promoter region Gene [Source:MGI Symbol;Acc:MGI:1922066]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7939 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23754 Nonsense Mutation detected in F1 DNA During 2014
sa14064 Essential Splice Site Available for shipment Available now
sa18388 Nonsense Available for shipment Available now
sa4112 Nonsense Mutation detected in F1 DNA During 2014
sa23753 Nonsense Mutation detected in F1 DNA During 2014
sa23752 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Essential Splice Site 86 2352 3 50
ENSDART00000109614 Essential Splice Site 86 2316 3 52
Genomic Location:
Chromosome 20 (position 34093942)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTAGAATYTGAATGTYATGCTTAATTGTATTTGCTCTTTTCGRTTAC[A/T]GAGGATGAGCTGAAATGTTTAAGAGAGAACAATAAGGAGCAAGCAGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Nonsense 1033 2352 23 50
ENSDART00000109614 Nonsense 1034 2316 24 52
Genomic Location:
Chromosome 20 (position 34085235)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACAGAACTTGCTGGAAGAGAAAAACAAAGCTGTTGCTGCTGTAGAG[C/T]AAGAGGTAGTGAATTTACACCTTGGATCACTACATTTTACCTGTTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14064
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Essential Splice Site 1573 2352 32 50
ENSDART00000109614 Essential Splice Site 1565 2316 33 52
Genomic Location:
Chromosome 20 (position 34079105)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAAGAAGGCCATATTAWTGGCCAAGCAGAAGATCAGTCARCTTACTGG[T/A]GAGAACTGACTCTTTTTGAGAWTAGTATGTGCTTTKAGTCTTTTTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Nonsense 1615 2352 33 50
ENSDART00000109614 Nonsense 1607 2316 34 52
Genomic Location:
Chromosome 20 (position 34078906)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTGAAGTCTCAGTATGARGGGCGTCTGAGCAGACAGGAAAGRGAGCTA[C/T]GAGACCTTCGCGAACARCAGGAGAGACATGGAGAACAGAGGGATGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Nonsense 1847 2352 37 50
ENSDART00000109614 Nonsense 1839 2316 38 52
Genomic Location:
Chromosome 20 (position 34076084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGCATCTCCTGGTAGTGCCTTAAGCAAGCGCCCCCGTGAAGAGGAA[C/T]AAGAGAGCATGTCTGCTGACACACAGTCCCAAGATGAGCCCAATGACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Nonsense 1929 2352 39 50
ENSDART00000109614 Nonsense 1921 2316 40 52
Genomic Location:
Chromosome 20 (position 34073698)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGAAATGGATGAGGAACCAGGACCATCTCAGTCTGTCCCTGGAGAT[C/T]GAATGCTGCCCCATCCATCTGAGACCCATCGAAGCCCAGAGGAGCCCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Essential Splice Site 2339 2352 None 50
ENSDART00000109614 Essential Splice Site 2303 2316 None 52
Genomic Location:
Chromosome 20 (position 34064252)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGACAGTGGACTGGTAGTCGAGGTTCTAGAAGCATTGTGAAGAGGGG[T/A]GAGACTTTTGTTTCTTATTTGTTAGTTTCTTAAACTTTTATTTCCTTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/er1y7vxj