tprb

Ensembl ID:
ENSDARG00000016630
ZFIN ID:
ZDB-GENE-030131-6410
Description:
nucleoprotein TPR [Source:RefSeq peptide;Acc:NP_001025294]
Human Orthologue:
TPR
Human Description:
translocated promoter region (to activated MET oncogene) [Source:HGNC Symbol;Acc:12017]
Mouse Orthologue:
Tpr
Mouse Description:
translocated promoter region Gene [Source:MGI Symbol;Acc:MGI:1922066]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37090 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39290 Nonsense Mutation detected in F1 DNA During 2016
sa29399 Nonsense Mutation detected in F1 DNA During 2016
sa37089 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37088 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23754 Nonsense Mutation detected in F1 DNA During 2016
sa43486 Nonsense Mutation detected in F1 DNA During 2016
sa14064 Essential Splice Site Available for shipment Available now
sa18388 Nonsense Available for shipment Available now
sa23753 Nonsense Mutation detected in F1 DNA During 2016
sa32305 Nonsense Mutation detected in F1 DNA During 2016
sa23752 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Essential Splice Site 86 2352 2 50
ENSDART00000109614 Essential Splice Site 86 2316 2 52
Genomic Location (Zv9):
Chromosome 20 (position 34094027)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34166540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCAGACTCAAGAACATCAGATCCTGAAAGAGGAGCACTATAAATTGGG[T/C]AAGTAGGTGTCAATCAAATGTCTATATTGTATTGTATTTAGAATTTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Nonsense 151 2352 5 50
ENSDART00000109614 Nonsense 152 2316 5 52
Genomic Location (Zv9):
Chromosome 20 (position 34092927)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34165440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATTATTATTATTGTTGTTTTACAGAGGACCTTAAGCGTCTTAATGAT[C/T]GATTGGTGGAAGTCAGTGCAGAAAAAATGCAGCTTCAGCTCAAACTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Nonsense 161 2352 5 50
ENSDART00000109614 Nonsense 162 2316 5 52
Genomic Location (Zv9):
Chromosome 20 (position 34092897)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34165410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTAAGCGTCTTAATGATCGATTGGTGGAAGTCAGTGCAGAAAAAATG[C/T]AGCTTCAGCTCAAACTGGAGGAGTCAGAAACCTCTGAAGTTTCAATCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Essential Splice Site 465 2352 12 50
ENSDART00000109614 Essential Splice Site 466 2316 13 52
Genomic Location (Zv9):
Chromosome 20 (position 34088500)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34161013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAAATCAGTTTCCAGTCTCTCTGCTAAATTAGAGCAAGCTGTCACG[G/T]TGAGAATTGAAAAGTTTTATTACATGTCACATTACCAGATGATTACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Essential Splice Site 465 2352 12 50
ENSDART00000109614 Essential Splice Site 466 2316 13 52
Genomic Location (Zv9):
Chromosome 20 (position 34088499)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34161012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAAATCAGTTTCCAGTCTCTCTGCTAAATTAGAGCAAGCTGTCACGG[T/C]GAGAATTGAAAAGTTTTATTACATGTCACATTACCAGATGATTACTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Nonsense 1033 2352 23 50
ENSDART00000109614 Nonsense 1034 2316 24 52
Genomic Location (Zv9):
Chromosome 20 (position 34085235)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34157748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACAGAACTTGCTGGAAGAGAAAAACAAAGCTGTTGCTGCTGTAGAG[C/T]AAGAGGTAGTGAATTTACACCTTGGATCACTACATTTTACCTGTTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Nonsense 1357 2352 29 50
ENSDART00000109614 Nonsense 1349 2316 30 52
Genomic Location (Zv9):
Chromosome 20 (position 34081072)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34153585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTTTAGCACCTGGTGAGCCAGCAAAAAGACACTGACCCGGAAGAGTA[C/A]AAGCGTCTGCACTCTGAGCGGGAAGCACATCTTAAACGCATCCAGCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14064
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Essential Splice Site 1573 2352 32 50
ENSDART00000109614 Essential Splice Site 1565 2316 33 52
Genomic Location (Zv9):
Chromosome 20 (position 34079105)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34151618
KASP Assay ID:
2261-4611.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAAGAAGGCCATATTAWTGGCCAAGCAGAAGATCAGTCARCTTACTGG[T/A]GAGAACTGACTCTTTTTGAGAWTAGTATGTGCTTTKAGTCTTTTTCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Nonsense 1615 2352 33 50
ENSDART00000109614 Nonsense 1607 2316 34 52
Genomic Location (Zv9):
Chromosome 20 (position 34078906)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34151419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTGAAGTCTCAGTATGARGGGCGTCTGAGCAGACAGGAAAGRGAGCTA[C/T]GAGACCTTCGCGAACARCAGGAGAGACATGGAGAACAGAGGGATGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Nonsense 1929 2352 39 50
ENSDART00000109614 Nonsense 1921 2316 40 52
Genomic Location (Zv9):
Chromosome 20 (position 34073698)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34146211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGAAATGGATGAGGAACCAGGACCATCTCAGTCTGTCCCTGGAGAT[C/T]GAATGCTGCCCCATCCATCTGAGACCCATCGAAGCCCAGAGGAGCCCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Nonsense 2201 2352 46 50
ENSDART00000109614 Nonsense 2165 2316 48 52
Genomic Location (Zv9):
Chromosome 20 (position 34066676)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34139189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCTTTTGTGCTGTGCAGGTTTAGGCATGTATGAGAGCTCTGTTTTTT[T/A]GGGATCTCATGAGGATGAGTCAGGGGGACGCAGTGTACCCACAACCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017941 Essential Splice Site 2339 2352 None 50
ENSDART00000109614 Essential Splice Site 2303 2316 None 52
Genomic Location (Zv9):
Chromosome 20 (position 34064252)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34136765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGACAGTGGACTGGTAGTCGAGGTTCTAGAAGCATTGTGAAGAGGGG[T/A]GAGACTTTTGTTTCTTATTTGTTAGTTTCTTAAACTTTTATTTCCTTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link