mcat

Ensembl ID:
ENSDARG00000016613
ZFIN ID:
ZDB-GENE-041111-231
Description:
malonyl-CoA-acyl carrier protein transacylase, mitochondrial [Source:RefSeq peptide;Acc:NP_00103850
Human Orthologue:
MCAT
Human Description:
malonyl CoA:ACP acyltransferase (mitochondrial) [Source:HGNC Symbol;Acc:29622]
Mouse Orthologue:
Mcat
Mouse Description:
malonyl CoA:ACP acyltransferase (mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:2388651]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9919 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021782 Nonsense 325 364 4 4
Genomic Location:
Chromosome 4 (position 17914983)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTGAAATGGGAGCAGACGCTGCATGAGATTTACCAAAGAGCCCAAGGA[C/T]AGGAGTTTCCYCACACATATGAGGTGGGACCTGGTAGACATTTGGGCTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4fv347c4