scrn3

Ensembl ID:
ENSDARG00000016611
ZFIN ID:
ZDB-GENE-030131-4783
Description:
Secernin-3 [Source:UniProtKB/Swiss-Prot;Acc:Q803W1]
Human Orthologue:
SCRN3
Human Description:
secernin 3 [Source:HGNC Symbol;Acc:30382]
Mouse Orthologue:
Scrn3
Mouse Description:
secernin 3 Gene [Source:MGI Symbol;Acc:MGI:1921866]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31697 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016710 Essential Splice Site 179 417 None 8
ENSDART00000135076 Essential Splice Site 179 245 None 5

The following transcripts of ENSDARG00000016611 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 2468157)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2518461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGCTGGAGACTGCTGGGAAACACTGGGCTGCGGAGAGAGTGGAGGG[T/C]AAATTAGGAATTAGGGATTAGTAATTAATTTAATATAAAGTTAATATTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link