ckmt1

Ensembl ID:
ENSDARG00000016598
ZFIN ID:
ZDB-GENE-030131-611
Description:
creatine kinase, mitochondrial 1 [Source:RefSeq peptide;Acc:NP_942096]
Human Orthologues:
CKMT1A, CKMT1B
Human Descriptions:
creatine kinase, mitochondrial 1A [Source:HGNC Symbol;Acc:31736]
creatine kinase, mitochondrial 1B [Source:HGNC Symbol;Acc:1995]
Mouse Orthologue:
Ckmt1
Mouse Description:
creatine kinase, mitochondrial 1, ubiquitous Gene [Source:MGI Symbol;Acc:MGI:99441]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44304 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027393 Nonsense 54 417 3 10
ENSDART00000148299 Nonsense 54 152 2 4
Genomic Location (Zv9):
Chromosome 25 (position 22505549)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21737425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCAGATGAAAGCTAAATCTTAGTTCTTTTTCTCAACAGTGCTGAATA[T/A]CCGGATTTGCGTAAGCACAATAACTGTATGGCCAGTCACCTGACTCCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link