ENSDARG00000016579

Ensembl ID:
ENSDARG00000016579
Human Orthologues:
PTPRK, PTPRM, PTPRT, PTPRU
Human Descriptions:
protein tyrosine phosphatase, receptor type, K [Source:HGNC Symbol;Acc:9674]
protein tyrosine phosphatase, receptor type, M [Source:HGNC Symbol;Acc:9675]
protein tyrosine phosphatase, receptor type, T [Source:HGNC Symbol;Acc:9682]
protein tyrosine phosphatase, receptor type, U [Source:HGNC Symbol;Acc:9683]
Mouse Orthologues:
Ptprk, Ptprm, Ptprt, Ptpru
Mouse Descriptions:
protein tyrosine phosphatase, receptor type, K Gene [Source:MGI Symbol;Acc:MGI:103310]
protein tyrosine phosphatase, receptor type, M Gene [Source:MGI Symbol;Acc:MGI:102694]
protein tyrosine phosphatase, receptor type, T Gene [Source:MGI Symbol;Acc:MGI:1321152]
protein tyrosine phosphatase, receptor type, U Gene [Source:MGI Symbol;Acc:MGI:1321151]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6819 Nonsense Mutation detected in F1 DNA During 2014
sa11271 Nonsense Available for shipment Available now
sa16068 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079875 Nonsense 399 775 7 13
ENSDART00000111665 Nonsense 399 893 7 14
ENSDART00000115246 None None 724 None 10
Genomic Location:
Chromosome 25 (position 38479355)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAACGCGTCTCGGTGTGTTTTYACTGGTCTGAYTCCTGGACAACAGTA[T/G]GAGCTGTCRGTGAAGACCASGAGTGGAGCTCGATCAGCTGAGCGGACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079875 None None 775 None 13
ENSDART00000111665 None None 893 None 14
ENSDART00000115246 Nonsense 402 724 5 10
Genomic Location:
Chromosome 25 (position 38479069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCTGGGATTTCTACCGTATYCTGCTGTTCAACGGCTCCTCTGTGCTG[G/T]AGAACCGGACGGTGGAGCGGCAGCGGCTGGAGATCAKCTTYACCAACTGS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079875 Splice Site None 775 None 13
ENSDART00000111665 Nonsense 738 893 12 14
ENSDART00000115246 Splice Site None 724 None 10
Genomic Location:
Chromosome 25 (position 38475996)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCGGGCCAGGAGAGATTCGTCCCCAAACACRTCAACGAGGTCAGCTTC[C/T]AGCATCTGCAGCCCGGACAGCAGTACAACATCACTRTTACGTCAATCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1runcqaj