heatr7a

Ensembl ID:
ENSDARG00000016573
ZFIN ID:
ZDB-GENE-090806-2
Human Orthologue:
HEATR7A
Human Description:
HEAT repeat containing 7A [Source:HGNC Symbol;Acc:26958]
Mouse Orthologue:
Heatr7a
Mouse Description:
HEAT repeat containing 7A Gene [Source:MGI Symbol;Acc:MGI:2442558]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4668 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7796 Nonsense Mutation detected in F1 DNA During 2014
sa22879 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22878 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018091 Essential Splice Site 59 1651 2 42
ENSDART00000136648 Essential Splice Site 59 615 2 17
ENSDART00000142638 None None 731 None 17
Genomic Location:
Chromosome 16 (position 33642181)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATAAAGTCYTGTCTATGTGYCAGGATTACCTGCTCAAACACCCRAAGG[T/C]TAGCCAAAGAATTTSCTTAAAACATCTGAGCTAGTNNNTGAAGACCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018091 Nonsense 318 1651 8 42
ENSDART00000136648 Nonsense 318 615 8 17
ENSDART00000142638 None None 731 None 17
Genomic Location:
Chromosome 16 (position 33627319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTCGAGTGCTGGAGACTCAGAYTGATGGACTGTTACTCGCTCTGCAC[C/T]AGCAGGTWAGTGTCTCCTCTCACTCGCTCTTTATGYGCTTCACCTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018091 Essential Splice Site 384 1651 10 42
ENSDART00000136648 Essential Splice Site 384 615 10 17
ENSDART00000142638 None None 731 None 17
Genomic Location:
Chromosome 16 (position 33621385)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCGAATGGGCTCGCTGGCGGTTCTCAGACACCTCATCAACTCTTCCAG[T/C]GAGTTTTTACACATTATCAAATATGTCACCAATGCTCTGATCCAGGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018091 Nonsense 1173 1651 32 42
ENSDART00000136648 None None 615 None 17
ENSDART00000142638 Nonsense 253 731 7 17
Genomic Location:
Chromosome 16 (position 33578450)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCTGTGAGATGTGGATGGCTCTGGGAGCGGACAGCACTCTGGCCCTA[C/T]AAATCATGGAGATGATTATCGAGAAGCTCAATGTCATGGTTCCCTATGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m7lh7d63