prlra

Ensembl ID:
ENSDARG00000016570
ZFIN ID:
ZDB-GENE-080103-2
Description:
prolactin receptor a [Source:RefSeq peptide;Acc:NP_001122149]
Human Orthologue:
PRLR
Human Description:
prolactin receptor [Source:HGNC Symbol;Acc:9446]
Mouse Orthologue:
Prlr
Mouse Description:
prolactin receptor Gene [Source:MGI Symbol;Acc:MGI:97763]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44958 Nonsense Mutation detected in F1 DNA During 2017
sa43590 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039549 Nonsense 369 605 8 8
ENSDART00000127866 Nonsense 369 605 9 9
ENSDART00000128859 Nonsense 370 606 9 9
Genomic Location (Zv9):
Chromosome 21 (position 9666274)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTTTTAGACAAGTGCATGGAAGGAAGTGGAAATGACCAACACAACTA[C/A]AGCCAGCACGGAGAAACAAGCTGGGCTTCTTCCAGCGAATGTAGCGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039549 Nonsense 437 605 8 8
ENSDART00000127866 Nonsense 437 605 9 9
ENSDART00000128859 Nonsense 438 606 9 9
Genomic Location (Zv9):
Chromosome 21 (position 9666477)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11038528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAAACCGGCCTACCACAGCGTCCCGGAGATCCTAAAACATTCACCAT[C/A]ACACGCAATCCCAAGCAACTACCACCAGCTTTACCTTCAGGACATCCCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link