IQSEC1

Ensembl ID:
ENSDARG00000016551
Description:
IQ motif and Sec7 domain 1 [Source:HGNC Symbol;Acc:29112]
Human Orthologue:
IQSEC1
Human Description:
IQ motif and Sec7 domain 1 [Source:HGNC Symbol;Acc:29112]
Mouse Orthologue:
Iqsec1
Mouse Description:
IQ motif and Sec7 domain 1 Gene [Source:MGI Symbol;Acc:MGI:1196356]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17586 Nonsense Available for shipment Available now
sa35097 Nonsense Mutation detected in F1 DNA During 2016
sa38847 Nonsense Mutation detected in F1 DNA During 2016
sa21927 Nonsense Available for shipment Available now
sa41851 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13437 Essential Splice Site Available for shipment Available now
sa35096 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043091 Nonsense 51 1252 1 16
Genomic Location (Zv9):
Chromosome 11 (position 27990484)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26819310
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGRAGTTGCTGGAGAAGCAGAAGAAYAGGATTGAAGAGCTCGAACAG[C/T]AAGTGTGTGATCTTTGTCAAGAAAACGCGTGCTTGAAGGATCAGCACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043091 Nonsense 577 1252 5 16
Genomic Location (Zv9):
Chromosome 11 (position 27673465)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26502291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCGCGGCAGCTGGAAAGCCATCTGGCTATCAATGGCACCGCCAACCGG[C/T]AAAGCAAATCCGAGTCTGACTTCTCTGATGGTGATAATGACAGCATCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043091 Nonsense 624 1252 5 16
Genomic Location (Zv9):
Chromosome 11 (position 27673322)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26502148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTTCCAGGGACAGTCTTCGAGAGCAGACTCTCAGTAAGCAGACGTA[T/G]CACAAGGAGACACGAAACAGTTGGGACTCGCCAGCATTTAGCAATGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043091 Nonsense 634 1252 5 16
Genomic Location (Zv9):
Chromosome 11 (position 27673293)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26502119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCTCAGTAAGCAGACGTATCACAAGGAGACACGAAACAGTTGGGACT[C/A]GCCAGCATTTAGCAATGATATCATCCGCAAGAGGCACTATCGAATTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043091 Essential Splice Site 710 1252 6 16
Genomic Location (Zv9):
Chromosome 11 (position 27667061)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26495887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAGTTCCTGGGCAACAGGCAGAAACAGTTCAACAGAGATGTTCTTGAG[T/C]AAGTTCAGTCATTTTAACTGGATGAAGTCCATGAAAATCACAGATGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043091 Essential Splice Site 807 1252 8 16
Genomic Location (Zv9):
Chromosome 11 (position 27662481)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26491307
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCAGAGAGGAAGATGAAACTAGAGGACTTTGTGAAGAACCYTCGCGG[T/A]AAGAATCATATCTAGAGTTTTTTTNNNCTNNGTTCAAAGTTACACAGTATGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043091 Nonsense 829 1252 9 16
Genomic Location (Zv9):
Chromosome 11 (position 27660223)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26489049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACATCCCGAGAGAGATGTTAGTGGGCATCTATGAGCGAATTCGTAAA[C/T]GAGAGCTTAAGACGAATGAAGACCATGTGTCCCAAGTGCAAAAGGTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link