IQSEC1

Ensembl ID:
ENSDARG00000016551
Description:
IQ motif and Sec7 domain 1 [Source:HGNC Symbol;Acc:29112]
Human Orthologue:
IQSEC1
Human Description:
IQ motif and Sec7 domain 1 [Source:HGNC Symbol;Acc:29112]
Mouse Orthologue:
Iqsec1
Mouse Description:
IQ motif and Sec7 domain 1 Gene [Source:MGI Symbol;Acc:MGI:1196356]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17586 Nonsense Available for shipment Available now
sa21927 Nonsense Mutation detected in F1 DNA During 2014
sa13437 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043091 Nonsense 51 1252 1 16
Genomic Location:
Chromosome 11 (position 27990484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGRAGTTGCTGGAGAAGCAGAAGAAYAGGATTGAAGAGCTCGAACAG[C/T]AAGTGTGTGATCTTTGTCAAGAAAACGCGTGCTTGAAGGATCAGCACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043091 Nonsense 634 1252 5 16
Genomic Location:
Chromosome 11 (position 27673293)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCTCAGTAAGCAGACGTATCACAAGGAGACACGAAACAGTTGGGACT[C/A]GCCAGCATTTAGCAATGATATCATCCGCAAGAGGCACTATCGAATTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043091 Essential Splice Site 807 1252 8 16
Genomic Location:
Chromosome 11 (position 27662481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCAGAGAGGAAGATGAAACTAGAGGACTTTGTGAAGAACCYTCGCGG[T/A]AAGAATCATATCTAGAGTTTTTTTNNNCTNNGTTCAAAGTTACACAGTATGAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yiz57wu0