si:ch211-254d18.3

Ensembl ID:
ENSDARG00000016548
ZFIN ID:
ZDB-GENE-050208-20
Description:
Novel protein (Im:6912504) [Source:UniProtKB/TrEMBL;Acc:B8A661]
Human Orthologue:
EIF5B
Human Description:
eukaryotic translation initiation factor 5B [Source:HGNC Symbol;Acc:30793]
Mouse Orthologue:
Eif5b
Mouse Description:
eukaryotic translation initiation factor 5B Gene [Source:MGI Symbol;Acc:MGI:2441772]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38289 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32742 Nonsense Mutation detected in F1 DNA During 2017
sa32743 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074689 Essential Splice Site 106 1231 3 25
ENSDART00000144245 Essential Splice Site 103 313 3 4
Genomic Location (Zv9):
Chromosome 1 (position 46404085)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45241597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCTAACATTAGAAAACCAAGGAGGAAAGGTTAAAGAAGCAGAAAAG[G/A]TATTGTAATTTTTTGTGTGAGAGATTATCAAGTTTATCCCTTTGCAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074689 Nonsense 287 1231 4 25
ENSDART00000144245 Nonsense 284 313 4 4
Genomic Location (Zv9):
Chromosome 1 (position 46406610)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45244122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGAGAGAGCCAAGCTGAAGGCCAAGAAAGAGAAGGAGGAAGAGGCTT[T/A]GAAATCTGCTGCTACACCTTCAACAGAGAGCAAGAAGCTGGAGAAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074689 Nonsense 692 1231 12 25
ENSDART00000144245   None 313 None 4
Genomic Location (Zv9):
Chromosome 1 (position 46415075)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 45252487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTCAACAGATCGGAGCCACCAACGTGCCCCTGGATACCATAGTGGAA[C/T]AAACCAAGATGGTGAAAAATGTGAGTATTTATTTATTTATTTATTTATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link