npas2

Ensembl ID:
ENSDARG00000016536
ZFIN ID:
ZDB-GENE-030408-3
Description:
neuronal PAS domain protein 2 [Source:RefSeq peptide;Acc:NP_840084]
Human Orthologue:
NPAS2
Human Description:
neuronal PAS domain protein 2 [Source:HGNC Symbol;Acc:7895]
Mouse Orthologue:
Npas2
Mouse Description:
neuronal PAS domain protein 2 Gene [Source:MGI Symbol;Acc:MGI:109232]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38465 Essential Splice Site Mutation detected in F1 DNA During 2017
sa26455 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33580 Nonsense Available for shipment Available now
sa20391 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014806 Essential Splice Site 197 845 6 21
Genomic Location (Zv9):
Chromosome 5 (position 24584412)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22297284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACACATGCTTCTGACTGAGTCTTCTACTGTAGACCTGCTCAACAGCA[G/A]TGAGTAAACTGCGCATAAACACACACACATGCACAAACACACAGACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014806 Essential Splice Site 198 845 6 21
Genomic Location (Zv9):
Chromosome 5 (position 24584413)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22297285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACACATGCTTCTGACTGAGTCTTCTACTGTAGACCTGCTCAACAGCAG[T/A]GAGTAAACTGCGCATAAACACACACACATGCACAAACACACAGACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014806 Nonsense 241 845 8 21
Genomic Location (Zv9):
Chromosome 5 (position 24589131)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22302003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACAGAATGTGTTGTTTTTGTGTGTGTTCCAGTGCCTCTGTCTTCATG[T/A]AATGGTTATGATCTGGCGTTTCCTCGCACGCTGCAGTCCTCAATAGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014806 Nonsense 349 845 11 21
Genomic Location (Zv9):
Chromosome 5 (position 24597503)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22310375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTTTGTGTGTATTGCAGTGATGCAGTGTGGGAAAGGAAAGTCTTGTTA[C/A]TATCGGTTCCTGACTAAAGGACAGCAGTGGATCTGGCTGCAGACGCACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link