si:ch211-184m19.1

Ensembl ID:
ENSDARG00000016532
ZFIN ID:
ZDB-GENE-030131-2941
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5TYS6]
Human Orthologue:
C1orf9
Human Description:
chromosome 1 open reading frame 9 [Source:HGNC Symbol;Acc:1240]
Mouse Orthologue:
AI848100
Mouse Description:
expressed sequence AI848100 Gene [Source:MGI Symbol;Acc:MGI:2138346]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23655 Nonsense Available for shipment Available now
sa31041 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36995 Nonsense Mutation detected in F1 DNA During 2017
sa36994 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026969 Nonsense 7 1314 1 23
ENSDART00000137605   None 300 None 10
ENSDART00000143590   None 1029 None 17
Genomic Location (Zv9):
Chromosome 20 (position 14696326)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14885572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCGAGGATGTTGGTCCCCGCGGGAAGATAATGAAGAAGCTGCGCGTGT[T/A]GTTCCTGTGCTCCGTTTTAGCTCTCCTGTGCTGGTAAGTCAAATCATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026969 Essential Splice Site 353 1314 7 23
ENSDART00000137605 Essential Splice Site 76 300 2 10
ENSDART00000143590 Essential Splice Site 76 1029 2 17
Genomic Location (Zv9):
Chromosome 20 (position 14635996)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14825242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCGTCGAATGCGGGGCCAAAATTCTTTCGGCCAACAACGAGGCTAAGG[T/G]AAATATGGTGCAGATGGTGGTAAAACAGCATTTGGAGCAGAAAAAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026969 Nonsense 490 1314 13 23
ENSDART00000137605 Nonsense 213 300 8 10
ENSDART00000143590 Nonsense 206 1029 7 17
Genomic Location (Zv9):
Chromosome 20 (position 14625339)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14814585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGTTTGGCACCAGTATGGTGGAGGAGTATGATGAGATTGCAGACTCT[C/T]AGTACACGTCAGAGAGAGCTGAATATCTGGATGAAGATTATGGTGAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026969 Nonsense 491 1314 13 23
ENSDART00000137605 Nonsense 214 300 8 10
ENSDART00000143590 Nonsense 207 1029 7 17
Genomic Location (Zv9):
Chromosome 20 (position 14625334)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14814580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGCACCAGTATGGTGGAGGAGTATGATGAGATTGCAGACTCTCAGTA[C/A]ACGTCAGAGAGAGCTGAATATCTGGATGAAGATTATGGTGAGATCAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link