ENSDARG00000016527

Ensembl ID:
ENSDARG00000016527
Human Orthologue:
RP4-697K14.7
Human Description:
Peroxisomal proliferator-activated receptor A-interacting complex 285 kDa protein [Source:UniProtKB/
Mouse Orthologue:
BC006779
Mouse Description:
cDNA sequence BC006779 Gene [Source:MGI Symbol;Acc:MGI:2385169]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8413 Nonsense Mutation detected in F1 DNA During 2014
sa8867 Nonsense Mutation detected in F1 DNA During 2014
sa18418 Nonsense Available for shipment Available now
sa15330 Nonsense Available for shipment Available now
sa20836 Nonsense Available for shipment Available now
sa8462 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7054 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20837 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 1308 2507 9 21
ENSDART00000018498 Nonsense 1308 2507 9 21
Genomic Location:
Chromosome 6 (position 58497490)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATCTCATTGATTATAGAAGTGGATGCRCAGACTAATCGCATAAAGAGA[A/T]GATTTWTCTGCAAGTCTGTGATTCACTCYAACAGGAAATTTTCCTAYGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 1308 2507 9 21
ENSDART00000018498 Nonsense 1308 2507 9 21
Genomic Location:
Chromosome 6 (position 58497490)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATCTCATTGATTATAGAAGTGGATGCRCAGACTAATCGCATAAAGAGA[A/T]GATTTWTCTGCAAGTCTGTGATTCACTCYAACAGGAAATTTTCCTAYGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 1448 2507 10 21
Genomic Location:
Chromosome 6 (position 58497934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTCAAGCTYATGAACTGAATAAGCAAGGTTTGATCCAGCACAACCCT[C/T]AGACYGACTCAGACACGTTCCCWGTGTTAAAATCAAWCCTCAGATGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 1589 2507 10 21
Genomic Location:
Chromosome 6 (position 58498358)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCAACARTCGGCCTATGAGAGGAAGGCAAATGCTCTGCATTTYGCAT[T/A]AAARCTKTCAAGCCAAAGTGAAAGGAAGGTGGCTTATATTGTGGAGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 1948 2507 10 21
Genomic Location:
Chromosome 6 (position 58499434)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGAATTGATTTTCTGATTAATCACATGCCCATGACAAACATTCCAGAA[C/T]AAATATTCCACGAGAGGACGAGATTTACGCTGGAGCTGATTCCAAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Essential Splice Site 2091 2507 13 21
Genomic Location:
Chromosome 6 (position 58502262)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTATTCTGTACTGTGGCCCGTCAAATAAATCTGTTGATGTTGTTGCAG[G/A]YAATGCAAAATTTTGTTTATAAAGCTTTTNTATWATTTGTATWCATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Essential Splice Site 2092 2507 13 21
Genomic Location:
Chromosome 6 (position 58502263)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTATTCTGTACTGTGGCCCGTCAAATAAATCTGTTGATGTTGTTGCAGG[T/C]AATGCAAAATTTTGTTTATAAAGCTTTTNTATTATTTGTATWCATGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018498 Nonsense 2200 2507 16 21
Genomic Location:
Chromosome 6 (position 58509742)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAAAAGGCTCGAAAGCATGAATTATTGCACCATGACGTAATCTTATG[C/A]ACGTGCACCGCAGCTTCACATCCAGCACTGGCGGAAACCCTTGACTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fxobsxb2