gata3

Ensembl ID:
ENSDARG00000016526
ZFIN ID:
ZDB-GENE-990415-82
Description:
Transcription factor GATA-3 [Source:UniProtKB/Swiss-Prot;Acc:Q91428]
Human Orthologue:
GATA3
Human Description:
GATA binding protein 3 [Source:HGNC Symbol;Acc:4172]
Mouse Orthologue:
Gata3
Mouse Description:
GATA binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:95663]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40303 Nonsense Mutation detected in F1 DNA During 2017
sa40302 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20285 Nonsense Available for shipment Available now
sa40301 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025153 Nonsense 37 438 1 5
Genomic Location (Zv9):
Chromosome 4 (position 24151369)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25075038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACACATCACCCAGGACTGGGACACTCCTACATGGACCCGTCGCAGTA[T/A]CAACTTGCGGAAGATGTGGATGTATTGTTTAATATCGACGGACAGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025153 Essential Splice Site 73 438 1 5
Genomic Location (Zv9):
Chromosome 4 (position 24151259)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25074928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACGGGAACCCGGTTCGGGCCGTGCAGAGATACCCACCGCCACCTCACA[G/A]TAAGTAAACCAGTTCTAAATTAGCCTTCGTTTTTTTACATTATCTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025153 Nonsense 89 438 2 5
Genomic Location (Zv9):
Chromosome 4 (position 24150214)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25073883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGTAGTCAGATGTGTCGCCCATCGTTGCTGCACGGCTCTCTTCCTTG[G/A]CTCGATGGAGGCAAATCTATCGGCCCTCACCACAGTACCTCCCCCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025153 Nonsense 331 438 4 5
Genomic Location (Zv9):
Chromosome 4 (position 24145583)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25069252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACCACGACGACACTGTGGCGGAGAAATGCCAACGGCGACCCTGTCTG[C/A]AATGCCTGCGGCCTGTATTACAAATTACACAATGTAAGCTCCCTAGCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hodgkin's lymphoma: A genome-wide association study of Hodgkin's lymphoma identifies new susceptibility loci at 2p16.1 (REL), 8q24.21 and 10p14 (GATA3). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link