ctdnep1a

Ensembl ID:
ENSDARG00000016519
ZFIN ID:
ZDB-GENE-041114-177
Description:
Serine/threonine-protein phosphatase dullard-A [Source:UniProtKB/Swiss-Prot;Acc:Q5U395]
Human Orthologue:
CTDNEP1
Human Description:
CTD nuclear envelope phosphatase 1 [Source:HGNC Symbol;Acc:19085]
Mouse Orthologue:
Dullard
Mouse Description:
Dullard homolog (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1914431]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33590 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029889 Essential Splice Site 35 245 1 8
Genomic Location (Zv9):
Chromosome 5 (position 25716846)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23544111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAATATGGAGTTTCTTTTTATACATCCTCAGGAAGCATCTACGAACGG[T/C]GAGCAGCACATCAACATCTGTCTGGGTGAACGCGAGATCATGTTTTCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link