rbm8a

Ensembl ID:
ENSDARG00000016516
ZFIN ID:
ZDB-GENE-050306-51
Description:
RNA-binding protein 8A [Source:UniProtKB/Swiss-Prot;Acc:Q5D018]
Human Orthologue:
RBM8A
Human Description:
RNA binding motif protein 8A [Source:HGNC Symbol;Acc:9905]
Mouse Orthologues:
B020018G12Rik, Rbm8a
Mouse Descriptions:
RIKEN cDNA B020018G12 gene Gene [Source:MGI Symbol;Acc:MGI:3612447]
RNA binding motif protein 8a Gene [Source:MGI Symbol;Acc:MGI:1913129]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42812 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018253 Nonsense 36 174 2 6
Genomic Location (Zv9):
Chromosome 16 (position 48986863)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45956084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTCTTTCAGAGAGCATTCATAAGTTAAAAGAGAAAGCCAAGAAGAGG[A/T]AAGGTCGTGGATTTGGATCTGGTAAGTTTTGTGTGTGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link