gtf2h2

Ensembl ID:
ENSDARG00000016514
ZFIN ID:
ZDB-GENE-030131-1959
Description:
general transcription factor IIH subunit 2 [Source:RefSeq peptide;Acc:NP_963875]
Human Orthologues:
GTF2H2, GTF2H2B, GTF2H2C
Human Descriptions:
general transcription factor IIH, polypeptide 2, 44kDa [Source:HGNC Symbol;Acc:4656]
general transcription factor IIH, polypeptide 2B [Source:HGNC Symbol;Acc:31393]
general transcription factor IIH, polypeptide 2C [Source:HGNC Symbol;Acc:31394]
Mouse Orthologue:
Gtf2h2
Mouse Description:
general transcription factor II H, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:1345669]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20423 Essential Splice Site Available for shipment Available now
sa20424 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007587 Essential Splice Site 157 392 None 15

The following transcripts of ENSDARG00000016514 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 27870572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTACCAACAATCTTGTGAACTATCCCGAACTGTATCTGTTTTATTGC[A/T]GACACATGCCTGCTCACACAAGCAGAGAAGTGCTGGTTATTTTCAGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007587 Nonsense 360 392 15 15

The following transcripts of ENSDARG00000016514 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 27877071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATGAATTGAAGCTTGATTATTTTTTCCCCTCCACAGGTGTTTACTTG[T/A]CTAGCATGTAAAAAGGTGTTCTGTGTGGAATGTGACATCTTCATACACGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hx01n4ij