setd3

Ensembl ID:
ENSDARG00000016513
ZFIN ID:
ZDB-GENE-030131-9137
Description:
SET domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_956348]
Human Orthologue:
SETD3
Human Description:
SET domain containing 3 [Source:HGNC Symbol;Acc:20493]
Mouse Orthologue:
Setd3
Mouse Description:
SET domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1289184]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28830 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022758 Nonsense 288 596 9 13
ENSDART00000127259 Nonsense 288 597 8 14
Genomic Location (Zv9):
Chromosome 17 (position 17885499)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 18035510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAACAATACTGAACTATTTTCCCTTCTATTATAGATCACAACTGGCTA[C/A]AATCTAGAAGATGACCGATGTGAATGCGTTGCTCTTAAAGATTACAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link