apbb1ip

Ensembl ID:
ENSDARG00000016505
ZFIN ID:
ZDB-GENE-040426-1318
Description:
Amyloid beta A4 precursor protein-binding family B member 1-interacting protein [Source:UniProtKB/Sw
Human Orthologue:
APBB1IP
Human Description:
amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein [Source:HGNC Sym
Mouse Orthologue:
Apbb1ip
Mouse Description:
amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13328 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021981 Essential Splice Site 163 645 4 13
ENSDART00000146830 Essential Splice Site 163 645 5 14
Genomic Location:
Chromosome 24 (position 6143677)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAATCAAGCTCGCTTTGGAGAAACTAAAGGAGGCCAAAGTTAAAAAGG[T/C]RAGTGTGGAAGTTGCCTAAAAAWCATTTAAAAAAATGTTGAAACCCTAWA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lsn9l6m6