cdk8

Ensembl ID:
ENSDARG00000016496
ZFIN ID:
ZDB-GENE-030903-2
Description:
Cell division protein kinase 8 [Source:UniProtKB/Swiss-Prot;Acc:Q8JH47]
Human Orthologue:
CDK8
Human Description:
cyclin-dependent kinase 8 [Source:HGNC Symbol;Acc:1779]
Mouse Orthologue:
Cdk8
Mouse Description:
cyclin-dependent kinase 8 Gene [Source:MGI Symbol;Acc:MGI:1196224]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24494 Nonsense Available for shipment Available now
sa44131 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007066 Nonsense 115 465 4 13

The following transcripts of ENSDARG00000016496 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 22137979)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21384857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGGTCTGCGTGTTTTTGCAGCACATCATCAAGTTCCACAGAGCCTCT[A/T]AGGCCAATAAGAAGCCTCTTCAGCTGCCGCGTGGGATGGTAAAGTCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007066 Nonsense 458 465 13 13

The following transcripts of ENSDARG00000016496 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 22146285)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21393163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCAAAGCAGCATGGGATACTCCTCTACCTCCCAGCAGCCTCCACAGTA[C/A]TCGCACCAGACCCATCGTTACTGAGTCAGGCCACACCCCTCCGCTCACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link