cdk8

Ensembl ID:
ENSDARG00000016496
ZFIN ID:
ZDB-GENE-030903-2
Description:
Cell division protein kinase 8 [Source:UniProtKB/Swiss-Prot;Acc:Q8JH47]
Human Orthologue:
CDK8
Human Description:
cyclin-dependent kinase 8 [Source:HGNC Symbol;Acc:1779]
Mouse Orthologue:
Cdk8
Mouse Description:
cyclin-dependent kinase 8 Gene [Source:MGI Symbol;Acc:MGI:1196224]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24494 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007066 Nonsense 115 465 4 13

The following transcripts of ENSDARG00000016496 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 22137979)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGGTCTGCGTGTTTTTGCAGCACATCATCAAGTTCCACAGAGCCTCT[A/T]AGGCCAATAAGAAGCCTCTTCAGCTGCCGCGTGGGATGGTAAAGTCTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dpu9r1ez