ddc

Ensembl ID:
ENSDARG00000016494
ZFIN ID:
ZDB-GENE-040426-2656
Description:
aromatic-L-amino-acid decarboxylase [Source:RefSeq peptide;Acc:NP_998507]
Human Orthologue:
DDC
Human Description:
dopa decarboxylase (aromatic L-amino acid decarboxylase) [Source:HGNC Symbol;Acc:2719]
Mouse Orthologue:
Ddc
Mouse Description:
dopa decarboxylase Gene [Source:MGI Symbol;Acc:MGI:94876]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36042 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028108 Essential Splice Site 381 480 None 14

The following transcripts of ENSDARG00000016494 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 9603284)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8389223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAATGATCTGCATATATCCTGTTTGCAATGTATTGTCGATCGTGTTTC[A/T]GCATGTAGGACTGGCTAAAGAGTTCGAGGCTTTCGTGAGAGCTGATCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link