im:7145503

Ensembl ID:
ENSDARG00000016491
ZFIN ID:
ZDB-GENE-050309-54
Description:
Im:7145503 protein [Source:UniProtKB/TrEMBL;Acc:Q58EC3]
Human Orthologue:
AGL
Human Description:
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase [Source:HGNC Symbol;Acc:321]
Mouse Orthologue:
Agl
Mouse Description:
amylo-1,6-glucosidase, 4-alpha-glucanotransferase Gene [Source:MGI Symbol;Acc:MGI:1924809]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16837 Nonsense Available for shipment Available now
sa13067 Nonsense Available for shipment Available now
sa8041 Nonsense Mutation detected in F1 DNA During 2014
sa6777 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16837
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021110 Nonsense 357 998 8 22
Genomic Location:
Chromosome 24 (position 30578534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYGGAAGTCTGACTGACAGCAASGTCGCTGGCAWCCTGAAAATATCTTTA[G/T]AATTGTGAGTCANTTTTTTTACCTCTATTTTGTCTGTTATTCACAAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13067
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021110 Nonsense 498 998 12 22
Genomic Location:
Chromosome 24 (position 30580703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YATATTTTTTAAAATGTGKRTAATGTCTTCCAGCTTTGTTCTGAATGGGT[C/A]GACCCTGGTCAAACAGCTGGCCCTGGGGTCAGTTCAGATGTGTGGGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021110 Nonsense 774 998 17 22
Genomic Location:
Chromosome 24 (position 30589351)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCGGTGCGCTGGCTGATGATGATGAATGAGACTGGACATTTTCCATA[T/A]TCCTCTGTCAAAATWCACAGAGATGGTACGTCAATCTGTAGCACATCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021110 Essential Splice Site 960 998 21 22
Genomic Location:
Chromosome 24 (position 30597005)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTWCCTGGTCAAGAATGTTCTGTCTAGACTTCACACCCATTTAGAAAG[G/T]TATTACCAAACAAAACAAAWCCAAAAAGTGGGTCAGATCGTGTGTTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7lx4gbf9