LOC555319

Ensembl ID:
ENSDARG00000016485
Human Orthologue:
CCDC39
Human Description:
coiled-coil domain containing 39 [Source:HGNC Symbol;Acc:25244]
Mouse Orthologue:
Ccdc39
Mouse Description:
coiled-coil domain containing 39 Gene [Source:MGI Symbol;Acc:MGI:1289263]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16342 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009476 Nonsense 548 947 12 20
Genomic Location:
Chromosome 2 (position 7461774)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAGATCCAGGAGGTGGAACTCTTCATTGAGACCTCTGAAAAAGAGMGG[A/T]AAAAAAGCAGGCTYAAAAAACAGGTGAATGRCTTGAMTTCTRCACTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vmueuwmf