dkc1

Ensembl ID:
ENSDARG00000016484
ZFIN ID:
ZDB-GENE-031118-120
Description:
dyskerin [Source:RefSeq peptide;Acc:NP_001028279]
Human Orthologue:
DKC1
Human Description:
dyskeratosis congenita 1, dyskerin [Source:HGNC Symbol;Acc:2890]
Mouse Orthologue:
Dkc1
Mouse Description:
dyskeratosis congenita 1, dyskerin homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1861727]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10276 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017176 Essential Splice Site 484 506 14 15
ENSDART00000126190   None 56 None 8
Genomic Location (Zv9):
Chromosome 21 (position 42121780)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43720826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGGCAGAGGAGGCAGCGGCCGAGGCTCCAGCGGAGGAAGAAACTGAGG[T/C]CAGCAAATAATATANNNNNNNNNNNNNNNNNNTCTGGACTCTTCAGCTTTATCCTGCTCTCMCTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link